SubtiBank SubtiBank
comEB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

comEB

late competence protein required for DNA binding and uptake
locus
BSU_25580
pI
5.37
mw
20.82 kDa
protein length
189 aa Sequence Blast
gene length
570 bp Sequence Blast
function
genetic compentence
product
late competence protein
essential
no
synonyms
comD

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • Gene

    Coordinates
    2,639,877 2,640,446

    The protein

    Protein family

  • [SW|Cytidine and deoxycytidylate deaminase family] (according to UniProt)
  • [SW|Domains]

  • [SW|CMP/dCMP-type deaminase domain] (aa 5–132) (according to UniProt)
  • Structure

  • [PDB|2HVV] (from Streptococcus mutans, 50% identity) [pubmed|18255096]
  • [SW|Localization]

  • localizes to one or both cell poles [Pubmed|21278288]
  • Expression and Regulation

    Operons

    genes
    [gene|788725411B2E741103603373E43441FD036E1BA0|comEA]-[gene|954359717E15DFC106A9D8111C6637E46B16F8C9|comEB]-[gene|363C6FE07C5E56FDE6BEC6ACFBA1A5535F0F64AC|comEC]
    description
    [Pubmed|7968523,19028902]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7968523], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8196543], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • view in new tab

    Other regulations

  • [protein|F21A75744FA0B25D5A251CB57E7A7DC6ABFF1DC7|ComN]: post-translation control,
  • Biological materials

    Mutant

  • BKE25580 ([gene|954359717E15DFC106A9D8111C6637E46B16F8C9|comEB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTGTTCCCTCCAAATG, downstream forward: _UP4_CTTTTCACGAGCTACGTGTG
  • BKK25580 ([gene|954359717E15DFC106A9D8111C6637E46B16F8C9|comEB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTGTTCCCTCCAAATG, downstream forward: _UP4_CTTTTCACGAGCTACGTGTG
  • References

  • 11814663,7968523,21278288,19028902,18255096