SubtiBank SubtiBank
comEB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

comEB

dCMP deaminase, late competence protein required for DNA binding and uptake, recruitment of [protein|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|ComGA] to the cell pole
locus
BSU_25580
pI
5.37
mw
20.82 kDa
protein length
189 aa Sequence Blast
gene length
570 bp Sequence Blast
function
recruitment of [protein|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|ComGA] to the cell pole
product
dCMP deaminase
essential
no
synonyms
comD

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • Gene

    Coordinates
    2,639,877 2,640,446

    The protein

    Catalyzed reaction/ biological activity

  • recruitment of [protein|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|ComGA] to the cell pole [pubmed|31954084]
  • deoxycytidylate monophosphate (dCMP) deaminase [pubmed|31954084]
  • Protein family

  • [SW|Cytidine and deoxycytidylate deaminase family] (according to UniProt)
  • [SW|Domains]

  • [SW|CMP/dCMP-type deaminase domain] (aa 5–132) (according to UniProt)
  • Structure

  • [PDB|2HVV] (from Streptococcus mutans, 50% identity) [pubmed|18255096]
  • [SW|Localization]

  • localizes to one or both cell poles [Pubmed|31954084,21278288]
  • Expression and Regulation

    Operons

    genes
    [gene|788725411B2E741103603373E43441FD036E1BA0|comEA]-[gene|954359717E15DFC106A9D8111C6637E46B16F8C9|comEB]-[gene|363C6FE07C5E56FDE6BEC6ACFBA1A5535F0F64AC|comEC]
    description
    [Pubmed|7968523,19028902]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7968523], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8196543], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • view in new tab

    Other regulations

  • [protein|F21A75744FA0B25D5A251CB57E7A7DC6ABFF1DC7|ComN]: post-translation control,
  • Biological materials

    Mutant

  • BKE25580 ([gene|954359717E15DFC106A9D8111C6637E46B16F8C9|comEB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTGTTCCCTCCAAATG, downstream forward: _UP4_CTTTTCACGAGCTACGTGTG
  • BKK25580 ([gene|954359717E15DFC106A9D8111C6637E46B16F8C9|comEB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTGTTCCCTCCAAATG, downstream forward: _UP4_CTTTTCACGAGCTACGTGTG
  • References

  • 11814663,7968523,21278288,19028902,18255096,31954084