SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


para-aminobenzoate synthase (subunit B)/ anthranilate synthase (subunit II)
21.54 kDa
protein length
194 aa Sequence Blast
gene length
585 bp Sequence Blast
biosynthesis of folate and tryptophan
para-aminobenzoate synthase (subunit B)/ anthranilate synthase (subunit II) glutamine amidotransferase (subunit B) and anthranilate synthase (subunit II)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of aromatic amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of folate]
  • Gene

    84,290 84,874

    The protein

    Catalyzed reaction/ biological activity

  • Chorismate + L-glutamine --> anthranilate + pyruvate + L-glutamate (according to UniProt)
  • [SW|Domains]

  • [SW|Glutamine amidotransferase type-1 domain] (aa 1-194) (according to UniProt)
  • Structure

  • [PDB|1I1Q] (from ''Salmonella typhimurium'', 42% identity) [Pubmed|11224570]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9084182], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • translation repressed by tryptophan ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|9084182]
  • view in new tab

    Other regulations

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: translation inhibition, [Pubmed|9084182]
  • additional information

  • the [gene|956E33AAAADB302EB8663E4B75C917242D3AD2C0|pabA]-[gene|865678B10097C40337F5EEA77FF0F6E7BF5358DC|pabC] part of the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • Biological materials


  • BKE00750 ([gene|956E33AAAADB302EB8663E4B75C917242D3AD2C0|pabA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAAATCATTTCTCCGC, downstream forward: _UP4_TATCGCAAGGAAGTTATTGC
  • BKK00750 ([gene|956E33AAAADB302EB8663E4B75C917242D3AD2C0|pabA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAAATCATTTCTCCGC, downstream forward: _UP4_TATCGCAAGGAAGTTATTGC
  • References


  • 16285852,19385727
  • Original Publications

  • 8647825,7515880,9084182,17114263,21815947,11224570