SubtiBank SubtiBank
yqeH
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yqeH

assembly/ stability of the 30S subunit of the ribosome, assembly of the 70S ribosome
locus
BSU_25670
pI
6.01
mw
40.84 kDa
protein length
366 aa Sequence Blast
gene length
1101 bp Sequence Blast
function
ribosome assembly
product
GTPase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.6|Ribosome assembly]
  • [category|SW 6|Groups of genes] → [category|SW 6.3|GTP-binding proteins]
  • Gene

    Coordinates
    2,645,490 2,646,590

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • defective in 16S rRNA 3' processing by [protein|E0437C86E5F3707FF1DA13C8B98F73130DED8FB4|YqfG] [pubmed|31003868]
  • The protein

    Catalyzed reaction/ biological activity

  • Binds and hydrolyzes GTP and readily exchanges GDP for GTP
  • Protein family

  • TRAFAC class YlqF/YawG GTPase family (together with [protein|54CD247926F7FABE4ACE85EB7021B62500B47260|RbgA] and [protein|519D4694B2895EE6F0D38D918F52F27734506848|CpgA], according to UniProt)
  • Paralogous protein(s)

  • [protein|9F6B78C1932FB56F7F71430DB16BC862A312407B|YnbA], [protein|B2270316642C66BC2DA86EBDCD1BF6A33CC6A1DC|YphC], [protein|C0F5FAD6DF89DA9E0FFC8F888D7CED6AA42D9C73|YyaF], [protein|CB68B3393CA7862C45C624AF7B1ADD188243A01F|Era], [protein|DF1A043F3D9817D9479B8C707F4ACEEF2BF2862C|YsxC], [protein|54CD247926F7FABE4ACE85EB7021B62500B47260|RbgA], [protein|66A6EC4F6CB91EE741BB9D7646913FF3EE602BD7|ThdF], [protein|84E7D672DB40B114DC4D96A4D8834958B47401A7|Obg]
  • [SW|Domains]

  • CP-type G domain (aa 59-222) (according to UniProt)
  • Structure

  • [PDB|3EC1] (Geobacillus stearothermophilus) [pubmed|18801747]
  • Expression and Regulation

    Operons

    genes
    [gene|722FD63050EED803C859FFD61338C02D5BB4CC1C|yqeG]-[gene|959C0ED7B9DA50F0EADCF1565405B878D36DA206|yqeH]-[gene|776D79C45DADA631D4A75B0773CFF471A87D9EEC|aroD]-[gene|7774FC36BAEAD33EDD48CB77DA0B5E7E0EA38CA2|yqeI]-[gene|AA4BB1F5B58371D536A6BBA86F6ECB5E5BFB12A8|nadD]-[gene|247C47AC70A0EA53E625871D9BC463A06E6B05FB|yqeK]-[gene|B9D5E9B566D28423232C1A28C966CDEA0E5A6B78|rsfS]-[gene|7F63251ABC07F6C11C57B62CBB948240B08D0181|yqeM]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE25670 ([gene|959C0ED7B9DA50F0EADCF1565405B878D36DA206|yqeH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTACTCCTCCCACT, downstream forward: _UP4_ATTTAAGAAAAGGGGAGAGG
  • BKK25670 ([gene|959C0ED7B9DA50F0EADCF1565405B878D36DA206|yqeH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTACTCCTCCCACT, downstream forward: _UP4_ATTTAAGAAAAGGGGAGAGG
  • labs

  • [SW|Naotake Ogasawara], Nara, Japan
  • References

    Reviews

  • 19575570,21885683
  • Original publications

  • 12427945,20376346,19540197,17895579,17237168,22383849,28189581,18801747,31003868