SubtiBank SubtiBank
yfkD
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yfkD

unknown
locus
BSU_07930
pI
10.16
mw
29.44 kDa
protein length
264 aa Sequence Blast
gene length
795 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    866,331 867,125

    Expression and Regulation

    Operons

    genes
    [gene|977695DBD3FF4C823E1A46E06C46706254F80891|chaA]-[gene|95B85312D4647B94AF04B912F818AB8345CCDCFD|yfkD]
    description
    [Pubmed|19543710]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|19543710], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed in the forespore ([protein|search|SigG]) [Pubmed|19543710]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C270 (yfkD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2268 NBRP B. subtilis, Japan]
  • BKE07930 ([gene|95B85312D4647B94AF04B912F818AB8345CCDCFD|yfkD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCACTCTTTCTATGGC, downstream forward: _UP4_TAAATAAAAAACTGATTCCA
  • BKK07930 ([gene|95B85312D4647B94AF04B912F818AB8345CCDCFD|yfkD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCACTCTTTCTATGGC, downstream forward: _UP4_TAAATAAAAAACTGATTCCA
  • References

  • 19543710