SubtiBank SubtiBank
yaaI
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yaaI

general stress protein, similar to isochorismatase
locus
BSU_00170
pI
4.67
mw
20.66 kDa
protein length
181 aa Sequence Blast
gene length
546 bp Sequence Blast
function
survival of ethanol stress
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    25,221 25,766

    The protein

    Protein family

  • [SW|Isochorismatase family] (according to UniProt)
  • Structure

  • [PDB|3TG2] (from Vibrio cholerae, 26% identity) [pubmed|22993087]
  • Additional information

  • important for survival of ethanol stress [Pubmed|15805528]
  • Expression and Regulation

    Operons

    genes
    [gene|95C78F511C49E04241D31593E6837BDFF48D6E14|yaaI]-[gene|77BEC74867422AA225A1F12AD63464656DBDCBE8|yaaH]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B890 (yaaI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1889 NBRP B. subtilis, Japan]
  • BKE00170 ([gene|95C78F511C49E04241D31593E6837BDFF48D6E14|yaaI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCGACAGTCTCCTTTCC, downstream forward: _UP4_TAAACATGATCAGCGCTTTT
  • BKK00170 ([gene|95C78F511C49E04241D31593E6837BDFF48D6E14|yaaI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCGACAGTCTCCTTTCC, downstream forward: _UP4_TAAACATGATCAGCGCTTTT
  • References

  • 15805528,15805528,22993087