SubtiBank SubtiBank
ygxB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ygxB

general stress protein
locus
BSU_09390
pI
10.24
mw
59.80 kDa
protein length
552 aa Sequence Blast
gene length
1659 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    1,013,958 1,015,616

    Expression and Regulation

    Operons

    genes
    [gene|95D74D90B289DD9787DC6D59A5DCD50F701951EB|ygxB]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B477 (ygxB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1476 NBRP B. subtilis, Japan]
  • BKE09390 ([gene|95D74D90B289DD9787DC6D59A5DCD50F701951EB|ygxB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATAGATAAGTCCAAGT, downstream forward: _UP4_TAAGCAAAAAACATGCACCC
  • BKK09390 ([gene|95D74D90B289DD9787DC6D59A5DCD50F701951EB|ygxB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATAGATAAGTCCAAGT, downstream forward: _UP4_TAAGCAAAAAACATGCACCC
  • References

  • 11544224