SubtiBank SubtiBank
yhfW

yhfW

similar to Rieske 2Fe-2S iron-sulfur protein
locus
BSU_10390
pI
5.66
mw
56.94 kDa
protein length
509 aa Sequence Blast
gene length
1530 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.4|Electron transport/ other/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,114,057 1,115,586

    The protein

    [SW|Domains]

  • Rieske domain (aa 423-509) (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Expression and Regulation

    Operons

    genes
    [gene|96136B1EDFAA1A34ED012CB5BA1DDFB8A95FB4A1|yhfW]
    description
    [Pubmed|15033535]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigF]) [Pubmed|15699190]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A716 (yhfW::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/716 NBRP B. subtilis, Japan]
  • BKE10390 ([gene|96136B1EDFAA1A34ED012CB5BA1DDFB8A95FB4A1|yhfW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGCCGTTATACCTCCAAT, downstream forward: _UP4_TAAACCGTTCATTTTAATGA
  • BKK10390 ([gene|96136B1EDFAA1A34ED012CB5BA1DDFB8A95FB4A1|yhfW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGCCGTTATACCTCCAAT, downstream forward: _UP4_TAAACCGTTCATTTTAATGA
  • References

  • 16497325,15033535,15699190