SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


general stress protein, synthesis of extracellular polysaccharide
49.61 kDa
protein length
420 aa Sequence Blast
gene length
1263 bp Sequence Blast
synthesis of extracellular polysaccharide

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    482,577 483,839

    The protein

    Protein family

  • [SW|glycosyltransferase 2 family] [Pubmed|27897378]
  • [SW|Localization]

  • cell membrane, forms clusters at the cell poles and septa (with [protein|70ED3CE683F3A3F785480F40986CABE7729C17C7|YdaK] and [protein|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|YdaN]) [Pubmed|27897378]
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|22383849], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • expressed during stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|22383849]
  • view in new tab

    Biological materials


  • MGNA-C076 (ydaM::erm), available at the [ NBRP B. subtilis, Japan]
  • JH642 and its derivatives: natural deletion of the 18 kb [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH] region encompassing the genes [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|7D5327BD1DD5FD5F90B2C849589923AA3D8B20EF|topB]-[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]-[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]-[gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]-[gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]-[gene|87834D5C47064BEFF26F086A8202C311F28F9D38|ydzK]-[gene|search|mntH ][pubmed|18670626]
  • BKE04300 ([gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTTAGCGAGATAAAGAACA, downstream forward: _UP4_CAACATAAAAGCGGGTGACC
  • BKK04300 ([gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTTAGCGAGATAAAGAACA, downstream forward: _UP4_CAACATAAAAGCGGGTGACC
  • References


  • 28296273
  • Original publications

  • 22383849,27897378