SubtiBank SubtiBank
htpG
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

htpG

class III heat-shock protein (molecular chaperone)
locus
BSU_39820
pI
4.67
mw
72.08 kDa
protein length
626 aa Sequence Blast
gene length
1881 bp Sequence Blast
function
chaperone
product
class III heat-shock protein (molecular chaperone)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.2|Chaperones/ protein folding]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • Gene

    Coordinates
    4,089,429 4,091,309

    The protein

    Protein family

  • heat shock protein 90 family (single member, according to UniProt)
  • Structure

  • [PDB|2IOQ] (from ''Escherichia coli'', 39% identity, 61% similarity) [Pubmed|17055434]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|962A955DED82EC0197757206A706796EC8F768BD|htpG]
    description
    [Pubmed|9150201]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9150201], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • induced by high temperature [Pubmed|9150201]
  • view in new tab

    Biological materials

    Mutant

  • GP1159 (del cat) available in [SW|Jörg Stülke]'s lab
  • BKE39820 ([gene|962A955DED82EC0197757206A706796EC8F768BD|htpG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCTTGATCGCTCCTTTA, downstream forward: _UP4_TAAACAGAAAAAGGAATCGT
  • BKK39820 ([gene|962A955DED82EC0197757206A706796EC8F768BD|htpG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCTTGATCGCTCCTTTA, downstream forward: _UP4_TAAACAGAAAAAGGAATCGT
  • References

  • 9150201,12511492,10323241