SubtiBank SubtiBank
thiT
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

thiT

S protein of thiamine [SW|ECF transporter]
locus
BSU_30990
pI
10.24
mw
20.31 kDa
protein length
192 aa Sequence Blast
gene length
579 bp Sequence Blast
function
thiamine uptake
product
S protein of thiamine [SW|ECF transporter]
essential
no
synonyms
yuaJ

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.3|ECF transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.3|ECF transporter] → [category|SW 1.2.3.2|The substrate-specific S components of the ECF transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.3|Biosynthesis/ acquisition of thiamine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,179,306 3,179,884

    The protein

    Protein family

  • vitamin uptake transporter (VUT/ECF) (TC 2.A.88) family (with [protein|97573C2D4FD8BE6B4C749C0644D053C9A0CBFFF3|TrpP] and [protein|7DD4BB8222B2EFE81C32C5521A29256095B9D6C1|YpdP], according to UniProt)
  • Structure

  • [PDB|3RLB] (from ''Lactococcus lactis'', 32% identity) [Pubmed|21706007]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|9685A380F95F1A73A693B53E4D35A1CB51043FEC|thiT]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box]: RNA switch, in [regulon|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box regulon]
  • regulation

  • repressed by thiamine ([regulon|Thi-box|Thi-box]) [Pubmed|12376536]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A222 (yuaJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/222 NBRP B. subtilis, Japan]
  • BKE30990 ([gene|9685A380F95F1A73A693B53E4D35A1CB51043FEC|thiT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTATCTCCTTCCATT, downstream forward: _UP4_TAAAAGTAACAATCCCCCAG
  • BKK30990 ([gene|9685A380F95F1A73A693B53E4D35A1CB51043FEC|thiT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTATCTCCTTCCATT, downstream forward: _UP4_TAAAAGTAACAATCCCCCAG
  • References

    Reviews

  • 20497229,22574898,24362466
  • Original publications

  • 16291685,21706007,18763711,12376536,23602660