SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


putative hypoxanthine exporter
41.38 kDa
protein length
388 aa Sequence Blast
gene length
1167 bp Sequence Blast
nucleotide metabolism
putative hypoxanthine exporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Nucleotide/ nucleoside transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.4|Nucleotide metabolism/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    625,125 626,291

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • DHA1 family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [regulon|a-box|a-box]: termination/antitermination, adenine-controlled, in [regulon|a-box|a-box]
  • regulation

  • induced by hypoxanthine and guanine, [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]-independent [Pubmed|12923093]
  • induced by adenine ([regulon|A-box|A-box]) [Pubmed|14718920]
  • view in new tab

    Biological materials


  • MGNA-C187 (ydhL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05800 ([gene|96B48D9B984010FECD2C194D7CF3CADFC22F2AA7|pbuE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAAACTCCTTTACTT, downstream forward: _UP4_TCCTTGTAAAAGGAGGATTT
  • BKK05800 ([gene|96B48D9B984010FECD2C194D7CF3CADFC22F2AA7|pbuE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAAACTCCTTTACTT, downstream forward: _UP4_TCCTTGTAAAAGGAGGATTT
  • References

  • 25550163,15629952,14718920,12923093,12923093,18441052,17935948,17853814,16931335,16201765,20022916,12787499,21283784,25573585