SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


putative hypoxanthine exporter
41.38 kDa
protein length
388 aa Sequence Blast
gene length
1167 bp Sequence Blast
nucleotide metabolism
putative hypoxanthine exporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Nucleotide/ nucleoside transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.4|Nucleotide metabolism/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    625,125 626,291

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • DHA1 family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [regulon|a-box|a-box]: termination/antitermination, adenine-controlled, in [regulon|a-box|a-box]
  • regulation

  • induced by hypoxanthine and guanine, [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]-independent [Pubmed|12923093]
  • induced by adenine ([regulon|A-box|A-box]) [Pubmed|14718920]
  • view in new tab

    Biological materials


  • MGNA-C187 (ydhL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05800 ([gene|96B48D9B984010FECD2C194D7CF3CADFC22F2AA7|pbuE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAAACTCCTTTACTT, downstream forward: _UP4_TCCTTGTAAAAGGAGGATTT
  • BKK05800 ([gene|96B48D9B984010FECD2C194D7CF3CADFC22F2AA7|pbuE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAAACTCCTTTACTT, downstream forward: _UP4_TCCTTGTAAAAGGAGGATTT
  • References

  • 25550163,15629952,14718920,12923093,12923093,18441052,17935948,17853814,16931335,16201765,20022916,12787499,21283784,25573585