SubtiBank SubtiBank
yitD
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yitD

phosphosulfolactate synthase
locus
BSU_10950
pI
4.38
mw
28.21 kDa
protein length
252 aa Sequence Blast
gene length
759 bp Sequence Blast
function
biosynthesis of L-sulfolactate
product
phosphosulfolactate synthase
essential
no
ec
4.4.1.19
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,173,333 1,174,091

    The protein

    Catalyzed reaction/ biological activity

  • (2R)-O-phospho-3-sulfolactate --> H+ + phosphoenolpyruvate + sulfite (according to UniProt)
  • Protein family

  • phosphosulfolactate synthase family (single member, according to UniProt)
  • Structure

  • [PDB|1U83]
  • Expression and Regulation

    Operons

    genes
    [gene|FA7147930DA90604BE2B4837A8A4393F72498AB1|yitC]-[gene|97156E7227E298B0DECC9AAC1411D0DAF3420C29|yitD]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed during [SW|sporulation] in the mother cell ([protein|search|SigE], [protein|search|SigK]) [Pubmed|15699190,15383836]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B178 (yitD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1177 NBRP B. subtilis, Japan]
  • BKE10950 ([gene|97156E7227E298B0DECC9AAC1411D0DAF3420C29|yitD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGGCAATTCTAGTGAAAAAT, downstream forward: _UP4_TAAAATAGCGGCTGCGGGGC
  • BKK10950 ([gene|97156E7227E298B0DECC9AAC1411D0DAF3420C29|yitD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGGCAATTCTAGTGAAAAAT, downstream forward: _UP4_TAAAATAGCGGCTGCGGGGC
  • References

  • 15699190,15383836