SubtiBank SubtiBank
rghR
The papers of the month are back! Check them out! Link here

rghR

transcriptional repressor ([SW|Xre family]) of [gene|4670F7C4CB9084A5BA478CAE238FA0F8C39F3A7E|rapD], [gene|E1744329B6489F989F93F3E71E51E772E3926ABF|rapG], [gene|search|rapH ]and [gene|AD4702CC69AC7D5FF391F14176881D582DD1C68A|yvaM]
locus
BSU33660
pI
6.18
mw
15.30 kDa
protein length
135 aa Sequence Blast
gene length
405 bp Sequence Blast
function
regulation of [SW|sporulation ]initiation
product
transcriptional repressor ([SW|Xre family])
essential
no
synonyms
yvaN

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay]
  • Gene

    Coordinates
    3,456,667 → 3,457,074

    The protein

    Protein family

  • [SW|Xre family]
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000196 PRODORIC2 database]
  • Biological materials

    Mutant

  • MGNA-A492 (yvaN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/492 NBRP B. subtilis, Japan]
  • BKE33660 (Δ[gene|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|rghR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATCTCACCCCGTCCC, downstream forward: _UP4_TGACTCTTGATAGAAATGTG
  • BKK33660 (Δ[gene|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|rghR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATCTCACCCCGTCCC, downstream forward: _UP4_TGACTCTTGATAGAAATGTG
  • References

  • 16553878,17227471