SubtiBank SubtiBank
ywtE
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ywtE

dephosphorylation of the riboflavin precursor, 5-amino-6-ribitylamino-2,4(1H,3H)-pyrimidinedione 5'-phosphate (minor activity)
locus
BSU_35850
pI
4.76
mw
31.44 kDa
protein length
286 aa Sequence Blast
gene length
861 bp Sequence Blast
function
dephosphorylation of the riboflavin precursor, 5-amino-6-ribitylamino-2,4(1H,3H)-pyrimidinedione 5'-phosphate (minor activity)
product
unknown
essential
no
ec
3.1.3.-
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.2|Biosynthesis/ acquisition of riboflavin/ FAD]
  • Gene

    Coordinates
    3,695,363 3,696,223

    The protein

    Catalyzed reaction/ biological activity

  • dephosphorylation of the riboflavin precursor, 5-amino-6-ribitylamino-2,4(1H,3H)-pyrimidinedione 5'-phosphate [Pubmed|26316208]
  • 5-amino-6-(5-phospho-D-ribitylamino)uracil + H2O --> 5-amino-6-(D-ribitylamino)uracil + phosphate (according to UniProt)
  • Protein family

  • [SW|HAD superfamily] (according to UniProt) [Pubmed|26316208]
  • [SW|Cof family] (according to UniProt)
  • Structure

  • [PDB|1NRW] ([protein|AF9523D3AA3C032B70175BCFFED34E9A42ED01AF|PhoC], 39% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|9730F7C18AC7CA68D144717851A0C261D9647E31|ywtE]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|68FE85BAA457199D34C9068F38756972CD2D280D|tagT]-[gene|9730F7C18AC7CA68D144717851A0C261D9647E31|ywtE]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • regulation

  • expressed at high salt concentrations ([protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]) [pubmed|18179421]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A546 (ywtE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/546 NBRP B. subtilis, Japan]
  • BKE35850 ([gene|9730F7C18AC7CA68D144717851A0C261D9647E31|ywtE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTAGGGGAACCTCCT, downstream forward: _UP4_TAAAGAAAAGACTCCAGAGA
  • BKK35850 ([gene|9730F7C18AC7CA68D144717851A0C261D9647E31|ywtE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTAGGGGAACCTCCT, downstream forward: _UP4_TAAAGAAAAGACTCCAGAGA
  • References

  • 26316208