SubtiBank SubtiBank
ypwA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypwA

carboxypeptidase, metalloprotease
locus
BSU_22080
pI
4.77
mw
58.01 kDa
protein length
501 aa Sequence Blast
gene length
1506 bp Sequence Blast
function
unknown
product
M32 carboxypeptidase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • Gene

    Coordinates
    2,320,355 2,321,860

    The protein

    Catalyzed reaction/ biological activity

  • Release of a C-terminal amino acid with broad specificity, except for -Pro (according to UniProt)
  • Protein family

  • peptidase M32 family (single member, according to UniProt)
  • Structure

  • [PDB|3HQ2] [Pubmed|19544567]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|9769C46DFFB6BD88E2224403F4EBC43351561A26|ypwA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A892 (ypwA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/892 NBRP B. subtilis, Japan]
  • BKE22080 ([gene|9769C46DFFB6BD88E2224403F4EBC43351561A26|ypwA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCATTCCCTCCCTAT, downstream forward: _UP4_TAATCAAAAGCCTGGCGGCG
  • BKK22080 ([gene|9769C46DFFB6BD88E2224403F4EBC43351561A26|ypwA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCATTCCCTCCCTAT, downstream forward: _UP4_TAATCAAAAGCCTGGCGGCG
  • References

  • 19544567