SubtiBank SubtiBank
yebE
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yebE

unknown
locus
BSU_06400
pI
9.62
mw
20.52 kDa
protein length
184 aa Sequence Blast
gene length
555 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yebF

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    697,538 698,092

    The protein

    Protein family

  • UPF0316 family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|976E12C93EB813D05EB3B46DE8579B98687F83DA|yebE]-[gene|B7348FDC2690B0A7E17A7ED10FB7CC5C55E15707|yebG]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE06400 ([gene|976E12C93EB813D05EB3B46DE8579B98687F83DA|yebE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATTCATCCCCCTAC, downstream forward: _UP4_AAGAAGAGGAGAATTAAAGA
  • BKK06400 ([gene|976E12C93EB813D05EB3B46DE8579B98687F83DA|yebE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATTCATCCCCCTAC, downstream forward: _UP4_AAGAAGAGGAGAATTAAAGA
  • References

  • 26577401