SubtiBank SubtiBank
chaA
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

chaA

H+/Ca2+ exchanger
locus
BSU07920
pI
5.21
mw
37.37 kDa
protein length
351 aa Sequence Blast
gene length
1053 bp Sequence Blast
function
calcium export
product
calcium export via proton antiporter
essential
no
synonyms
yfkE

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.5|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW 1.3.1.4|Metal ion homeostasis/ Other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    865,205 → 866,260

    The protein

    Structure

  • [PDB|4KJS] [Pubmed|23798403]
  • [SW|Localization]

  • cell membrane [Pubmed|23798403]
  • Expression and Regulation

    Operons

    genes
    [gene|977695DBD3FF4C823E1A46E06C46706254F80891|chaA]-[gene|95B85312D4647B94AF04B912F818AB8345CCDCFD|yfkD]
    description
    [Pubmed|19543710]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|19543710], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed in the forespore ([protein|search|SigG]) [Pubmed|19543710]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C269 (yfkE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2267 NBRP B. subtilis, Japan]
  • BKE07920 (Δ[gene|977695DBD3FF4C823E1A46E06C46706254F80891|chaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTGAAATAGCTCCTTT, downstream forward: _UP4_TAACCTGAAAAAATGATGGA
  • BKK07920 (Δ[gene|977695DBD3FF4C823E1A46E06C46706254F80891|chaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTGAAATAGCTCCTTT, downstream forward: _UP4_TAACCTGAAAAAATGATGGA
  • References

  • 19543710,23798403