SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


H+/Ca2+ exchanger
37.37 kDa
protein length
351 aa Sequence Blast
gene length
1056 bp Sequence Blast
calcium export
calcium export via proton antiporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW|Metal ion homeostasis/ Other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    865,205 866,260

    The protein

    Protein family

  • Ca(2+):cation antiporter (CaCA) (TC 2.A.19) family (single member, according to UniProt)
  • Structure

  • [PDB|4KJS] [Pubmed|23798403]
  • [SW|Localization]

  • cell membrane [Pubmed|30602489,23798403]
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|19543710], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed in the forespore ([protein|search|SigG]) [Pubmed|19543710]
  • view in new tab

    Biological materials


  • MGNA-C269 (yfkE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07920 ([gene|977695DBD3FF4C823E1A46E06C46706254F80891|chaA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTGAAATAGCTCCTTT, downstream forward: _UP4_TAACCTGAAAAAATGATGGA
  • BKK07920 ([gene|977695DBD3FF4C823E1A46E06C46706254F80891|chaA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTGAAATAGCTCCTTT, downstream forward: _UP4_TAACCTGAAAAAATGATGGA
  • References

  • 19543710,23798403,30602489