SubtiBank SubtiBank
chaA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

chaA

H+/Ca2+ exchanger
locus
BSU_07920
pI
5.21
mw
37.37 kDa
protein length
351 aa Sequence Blast
gene length
1056 bp Sequence Blast
function
calcium export
product
calcium export via proton antiporter
essential
no
synonyms
yfkE

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.5|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW 1.3.1.4|Metal ion homeostasis/ Other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    865,205 866,260

    The protein

    Protein family

  • Ca(2+):cation antiporter (CaCA) (TC 2.A.19) family (single member, according to UniProt)
  • Structure

  • [PDB|4KJS] [Pubmed|23798403]
  • [SW|Localization]

  • cell membrane [Pubmed|30602489,23798403]
  • Expression and Regulation

    Operons

    genes
    [gene|977695DBD3FF4C823E1A46E06C46706254F80891|chaA]-[gene|95B85312D4647B94AF04B912F818AB8345CCDCFD|yfkD]
    description
    [Pubmed|19543710]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|19543710], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed in the forespore ([protein|search|SigG]) [Pubmed|19543710]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C269 (yfkE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2267 NBRP B. subtilis, Japan]
  • BKE07920 ([gene|977695DBD3FF4C823E1A46E06C46706254F80891|chaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTGAAATAGCTCCTTT, downstream forward: _UP4_TAACCTGAAAAAATGATGGA
  • BKK07920 ([gene|977695DBD3FF4C823E1A46E06C46706254F80891|chaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTGAAATAGCTCCTTT, downstream forward: _UP4_TAACCTGAAAAAATGATGGA
  • References

  • 19543710,23798403,30602489,32341169