SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


oxalate decarboxylase
43.41 kDa
protein length
385 aa Sequence Blast
gene length
1158 bp Sequence Blast
oxalate decarboxylase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.3|Acid stress proteins (controlled by YvrI-YvrHa)]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    3,410,466 3,411,623

    The protein

    Catalyzed reaction/ biological activity

  • H+ + oxalate --> CO2 + formate (according to UniProt)
  • Paralogous protein(s)

  • [protein|1568DD457FDD482B3C14954A95F62BE338CBD15D|OxdD]
  • Modification

  • phosphorylated on Arg-12 [Pubmed|22517742]
  • [SW|Cofactors]

  • requires two Mn(II) centers for activity [Pubmed|24444454,19473032]
  • Structure

  • [PDB|1L3J] [pubmed|14871895]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|6359025A73C0BD313F5BCC6F56FE88B820902AAA|SigO]: sigma factor, [Pubmed|19047353], in [regulon|6359025A73C0BD313F5BCC6F56FE88B820902AAA|SigO regulon]
  • [protein|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA]: sigma factor, in [regulon|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA regulon]
  • regulation

  • induced by acidic growth conditions [Pubmed|19047353]
  • view in new tab

    Biological materials


  • MGNA-B053 (yvrK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33240 ([gene|9793E952C985BA268AC28C907900A03F4E8A3253|oxdC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAATGTTTCCTCCTTA, downstream forward: _UP4_TAAAAGACTTGCGGCTTGCA
  • BKK33240 ([gene|9793E952C985BA268AC28C907900A03F4E8A3253|oxdC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAATGTTTCCTCCTTA, downstream forward: _UP4_TAAAAGACTTGCGGCTTGCA
  • labs

  • [SW|John Helmann], Cornell University, USA [ Homepage]
  • References


  • 20464388
  • Original publications

  • 12056897,18573182,17269748,14871895,10960116,19047353,19473032,11546787,15583401,21264418,21782782,22404040,23734819,25526893,21277974,22517742,24444454,25186982,26641915,26744902,27797181,14871895,29620872,30806021