SubtiBank SubtiBank
thiD
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

thiD

4-amino-5-hydroxymethyl-2-methylpyrimidine and 4-amino-5-hydroxymethyl-2-methylpyrimidine pyrophosphate kinase
locus
BSU_11710
pI
5.71
mw
28.97 kDa
protein length
271 aa Sequence Blast
gene length
816 bp Sequence Blast
function
biosynthesis of thiamine pyrophosphate (TPP)
product
4-amino-5-hydroxymethyl-2-methylpyrimidinepyrophosphate kinase
essential
no
ec
2.7.1.49
synonyms
yjbV

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.3|Biosynthesis/ acquisition of thiamine]
  • Gene

    Coordinates
    1,246,837 1,247,652

    The protein

    Catalyzed reaction/ biological activity

  • 4-amino-5-hydroxymethyl-2-methylpyrimidine + ATP --> 4-amino-2-methyl-5-(phosphooxymethyl)pyrimidine + ADP + H+ (according to UniProt)
  • 4-amino-2-methyl-5-(phosphooxymethyl)pyrimidine + ATP --> 4-amino-2-methyl-5-(diphosphooxymethyl)pyrimidine + ADP (according to UniProt)
  • Protein family

  • ThiD family (with [protein|FEDD589EA9982856730E809F21B7930F688FDC42|PdxK], according to UniProt)
  • Paralogous protein(s)

  • [protein|FEDD589EA9982856730E809F21B7930F688FDC42|PdxK]
  • Structure

  • [PDB|2I5B] [Pubmed|16978644]
  • Expression and Regulation

    Operons

    genes
    [gene|47E47FB7D9C079DF603906694C4649A049814346|tenA]-[gene|CA6AAE8AC5B5EF01A911B035F8782579CD876C08|tenI]-[gene|87B5C84B7EE10F60B545CCFEF6A527A546B80432|thiO]-[gene|95DA3F899037140F48B99E065C768356CE08FA94|thiS]-[gene|B58B8F260E446E28BC2E3A9AA84EA771EC0A8634|thiG]-[gene|CCD3DDE9E52FCD4906735059CF30593BEB56FD1B|thiF]-[gene|97EDB4ACD64C5FA2E6014ED133DF18F602FF58BB|thiD]
    description
    [Pubmed|1898926]

    regulatory mechanism

  • [protein|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box]: [SW|RNA switch], via [SW|RNA switch], in [regulon|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box regulon]
  • regulation

  • repressed by thiamine ([SW|Thi-box]) [Pubmed|16356850]
  • the [SW|Thi-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B167 (yjbV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1166 NBRP B. subtilis, Japan]
  • BKE11710 ([gene|97EDB4ACD64C5FA2E6014ED133DF18F602FF58BB|thiD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTCATTACACTACACTCCT, downstream forward: _UP4_TGAGATCACCAGCTGATGGT
  • BKK11710 ([gene|97EDB4ACD64C5FA2E6014ED133DF18F602FF58BB|thiD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTCATTACACTACACTCCT, downstream forward: _UP4_TGAGATCACCAGCTGATGGT
  • References

    Reviews

  • 19348578,10382260
  • Original publications

  • 14973012,16978644