SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


4-amino-5-hydroxymethyl-2-methylpyrimidine and 4-amino-5-hydroxymethyl-2-methylpyrimidine pyrophosphate kinase
28.97 kDa
protein length
271 aa Sequence Blast
gene length
816 bp Sequence Blast
biosynthesis of thiamine pyrophosphate (TPP)
4-amino-5-hydroxymethyl-2-methylpyrimidinepyrophosphate kinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis/ acquisition of thiamine]
  • Gene

    1,246,837 1,247,652

    The protein

    Catalyzed reaction/ biological activity

  • 4-amino-5-hydroxymethyl-2-methylpyrimidine + ATP --> 4-amino-2-methyl-5-(phosphooxymethyl)pyrimidine + ADP + H+ (according to UniProt)
  • 4-amino-2-methyl-5-(phosphooxymethyl)pyrimidine + ATP --> 4-amino-2-methyl-5-(diphosphooxymethyl)pyrimidine + ADP (according to UniProt)
  • Protein family

  • ThiD family (with [protein|FEDD589EA9982856730E809F21B7930F688FDC42|PdxK], according to UniProt)
  • Paralogous protein(s)

  • [protein|FEDD589EA9982856730E809F21B7930F688FDC42|PdxK]
  • Structure

  • [PDB|2I5B] [Pubmed|16978644]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box]: [SW|RNA switch], via [SW|RNA switch], in [regulon|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box regulon]
  • regulation

  • repressed by thiamine ([SW|Thi-box]) [Pubmed|16356850]
  • the [SW|Thi-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • MGNA-B167 (yjbV::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE11710 ([gene|97EDB4ACD64C5FA2E6014ED133DF18F602FF58BB|thiD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTCATTACACTACACTCCT, downstream forward: _UP4_TGAGATCACCAGCTGATGGT
  • BKK11710 ([gene|97EDB4ACD64C5FA2E6014ED133DF18F602FF58BB|thiD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTCATTACACTACACTCCT, downstream forward: _UP4_TGAGATCACCAGCTGATGGT
  • References


  • 19348578,10382260
  • Original publications

  • 14973012,16978644