SubtiBank SubtiBank
comER
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

comER

control of biofilm formation and sporulation via the phosphorelay
locus
BSU_25600
pI
6.18
mw
30.09 kDa
protein length
273 aa Sequence Blast
gene length
822 bp Sequence Blast
function
control of biofilm formation and sporulation via the phosphorelay
product
putative pyrroline-5-carboxylate reductase
essential
no
synonyms
comED

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,641,214 2,642,035

    Phenotypes of a mutant

  • defects in [SW|biofilm formation] and a delay in [SW|sporulation] [Pubmed|27446060]
  • The protein

    Catalyzed reaction/ biological activity

  • 1-pyrroline-5-carboxylate + NADPH + H+ --> L-proline + NADP+, activity is biologically not relevant [pubmed|28824574]
  • Protein family

  • [SW|pyrroline-5-carboxylate reductase family] [pubmed|28824574]
  • Expression and Regulation

    Operons

    genes
    [gene|9840EA950FD7F4D18FDD0AB9AC65491E9F8BCC1C|comER]
    description
    [Pubmed|7968523]

    regulation

  • repressed by casamino acids [Pubmed|12107147]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|comER]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • BKE25600 ([gene|9840EA950FD7F4D18FDD0AB9AC65491E9F8BCC1C|comER]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGGTTTCCCCTCCTTTG, downstream forward: _UP4_TAGACGAGTATGTCATACGT
  • BKK25600 ([gene|9840EA950FD7F4D18FDD0AB9AC65491E9F8BCC1C|comER]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGGTTTCCCCTCCTTTG, downstream forward: _UP4_TAGACGAGTATGTCATACGT
  • References

  • 11814663,7968523,11418582,12107147,20525796,27446060,28824574