SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


phosphotransferase of the [SW|sporulation] initiation [SW|phosphorelay]
14.09 kDa
protein length
124 aa Sequence Blast
gene length
375 bp Sequence Blast
initiation of [SW|sporulation]
phosphotransferase of the sporulation initiation phosphorelay

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW|The phosphotransferases]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW|The phosphotransferases]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    3,809,550 3,809,924

    The protein


  • phosphorylated on an Asp residue by [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|KinA], [protein|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|KinB], [protein|A656321846B2E0D1F39B528E2D8B8E620CCD1148|KinC], [protein|511E71BB1981758857854C8E9BF657287CE60C11|KinD], or [protein|1582E81F7DA85F38D6732D341ABD0F052587F25A|KinE]
  • dephosphorylated by [protein|25D89EF3C4D57B3E6F9AB0210029651F74356906|RapA], [protein|E07E123CC9FB3B29DDA8EC58A33FEEE1DDFC4834|RapB], [protein|8B8646DF7F437D8DB299A77BA937DC6FC082102F|RapE], or [protein|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|RapH] [Pubmed|17581123]
  • Structure

  • [PDB|1SRR] (phosphatase resistant mutant)
  • [PDB|1F51] (complex with [protein|29D91115BB3AC03538D618E54A5A57F92777EFF6|Spo0B])
  • [PDB|2JVK] (Mutant L66A),
  • [PDB|2FSP]
  • [PDB|3Q15] ([protein|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|RapH]-[protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F] complex) [Pubmed|21346797]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2457578], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|1569009], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|8483422], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|8483422]
  • view in new tab

    Biological materials


  • BKE37130 ([gene|9896B99346B0D3F6D57F57377DB253B46135A37A|spo0F]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTACACCCCAATATTA, downstream forward: _UP4_TGACAAAAAGAAGAAACAAA
  • BKK37130 ([gene|9896B99346B0D3F6D57F57377DB253B46135A37A|spo0F]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTACACCCCAATATTA, downstream forward: _UP4_TGACAAAAAGAAGAAACAAA
  • References


  • 28886686
  • Original Publications

  • 20413551,9299348,9335530,11923303,8608130,16788205,12067336,8497199,10094672,15299688,8643670,8805550,26165942,11069677,2997779,8483422,16333746,2118512,10997904,9601032,9254596,8730857,10411754,17350627,21346797,9341920,9843420,2509430,1846779,9540996,9477965,17581123,8483422,2457578,1569009,23490197,21346797,22267516,23524609,25598361,27501195,30125296,30212463