SubtiBank SubtiBank
ycnK
The papers of the month are back! Check them out! Link here

ycnK

copper-responsive transcription repressor of the [gene|98D807FBB847BF731B5C236557C8F70347279CE0|ycnK]-[gene|D0F553E661A35C69380ACB01D9A96FC6C5088470|ycnJ]-[gene|1B7F59F954A1F20F75F5D4953F84CE58171741DE|ycnI] operon, [SW|DeoR family]
locus
BSU03960
pI
7.37
mw
21.29 kDa
protein length
190 aa Sequence Blast
gene length
570 bp Sequence Blast
function
regulation of copper uptake
product
transcription repressor, [SW|DeoR family]
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW 1.3.2.1|Copper]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    448,461 → 449,033

    Phenotypes of a mutant

  • elevated expression of ''[gene|D0F553E661A35C69380ACB01D9A96FC6C5088470|ycnJ]'' under conditions of copper excess [Pubmed|19168619]
  • The protein

    Catalyzed reaction/ biological activity

  • repression of ''[gene|98D807FBB847BF731B5C236557C8F70347279CE0|ycnK]-[gene|D0F553E661A35C69380ACB01D9A96FC6C5088470|ycnJ]-[gene|1B7F59F954A1F20F75F5D4953F84CE58171741DE|ycnI]'' expression in the presence of excess copper [Pubmed|22904286,19168619]
  • Protein family

  • DeoR family of transcription factors
  • [SW|Cofactors]

  • copper acts as corepressor [Pubmed|19168619]
  • Expression and Regulation

    Operons

    genes
    [gene|98D807FBB847BF731B5C236557C8F70347279CE0|ycnK]-[gene|D0F553E661A35C69380ACB01D9A96FC6C5088470|ycnJ]-[gene|1B7F59F954A1F20F75F5D4953F84CE58171741DE|ycnI]
    description
    [Pubmed|22904286,22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22904286], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|98D807FBB847BF731B5C236557C8F70347279CE0|YcnK]: repression, [Pubmed|22904286,19168619], in [regulon|98D807FBB847BF731B5C236557C8F70347279CE0|YcnK regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|15101989], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by copper limitation ([protein|search|YcnK]) [Pubmed|22904286,19168619]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C017 (ycnK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2015 NBRP B. subtilis, Japan]
  • BKE03960 (Δ[gene|98D807FBB847BF731B5C236557C8F70347279CE0|ycnK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATACACCCTCTTCAT, downstream forward: _UP4_TAACACAACACATACAGCGG
  • BKK03960 (Δ[gene|98D807FBB847BF731B5C236557C8F70347279CE0|ycnK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATACACCCTCTTCAT, downstream forward: _UP4_TAACACAACACATACAGCGG
  • Labs working on this gene/protein

  • [SW|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]
  • References

    Reviews

  • 22918892,25209494
  • Original publications

  • 19168619,22904286,22383849,15101989