SubtiBank SubtiBank
bsaA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bsaA

similar to glutathione peroxidase
locus
BSU_21900
pI
5.25
mw
18.11 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,304,553 2,305,035

    The protein

    Protein family

  • glutathione peroxidase family (single member, according to UniProt)
  • Structure

  • [PDB|2WGR] (Schistosoma mansoni phospholipid glutathione peroxidase, 49% identity) [pubmed|19714775]
  • Additional information

  • The gene is annotated in KEGG as glutathione peroxidase EC 1.11.1.9. It is marked in Swiss-Prot as glutathione peroxidase homolog and in MetaCyc as glutathione peroxidase. Several studies suggested that glutathione is probably absent in ''B. subtilis''. [Pubmed|19935659]
  • Expression and Regulation

    Operons

    genes
    [gene|9929712AC9E5581DD0EF3213CC49A0E6C8D3087D|bsaA]-[gene|A0CC440185318F7F8665AF7A8279C79A09E35518|ypgQ]-[gene|B42367583867799BD88D737C848E16B9143C5957|ypgR]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A887 (bsaA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/887 NBRP B. subtilis, Japan]
  • BKE21900 ([gene|9929712AC9E5581DD0EF3213CC49A0E6C8D3087D|bsaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAGTCCCTCCTATGT, downstream forward: _UP4_GAGCAATAAAAAGAGGGTGT
  • BKK21900 ([gene|9929712AC9E5581DD0EF3213CC49A0E6C8D3087D|bsaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAGTCCCTCCTATGT, downstream forward: _UP4_GAGCAATAAAAAGAGGGTGT
  • References

  • 8969496,19935659,19714775