SubtiBank SubtiBank
yrrT

yrrT

putative AdoMet-dependent methyltransferase
locus
BSU_27280
pI
4.97
mw
24.05 kDa
protein length
213 aa Sequence Blast
gene length
642 bp Sequence Blast
function
methionine salvage
product
putative AdoMet-dependent methyltransferase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,787,846 2,788,487

    The protein

    Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • [SW|Cofactors]

  • SAM (according to UniProt)
  • Structure

  • [PDB|3HNR] (from B. thuringiensis, 55% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|992A24CF9492965BF0E9EEFBB6F0A06871275068|yrrT]-[gene|5B21D1E73A65B13CE4DDA32ABC71EFA54E8D1D8F|mtnN]-[gene|F195C47849F4F6B4C56E3A386F5D8C84326B01C4|mccA]-[gene|314CB4923D15140E72B0ABAFE3E8BE9CA7310E10|mccB]-[gene|177EFFDCA6E3C3BB840EED13D9F2D71F99B833B6|yrhC]
    description
    [Pubmed|17056751]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16513748], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16513748], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|12642660,16885442], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • repressed in the presence of cysteine ([protein|search|CymR]) [Pubmed|16513748]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A851 (yrrT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/851 NBRP B. subtilis, Japan]
  • BKE27280 ([gene|992A24CF9492965BF0E9EEFBB6F0A06871275068|yrrT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTGTCACACTCCATA, downstream forward: _UP4_TAAAGTGAAGGGAATGTGAA
  • BKK27280 ([gene|992A24CF9492965BF0E9EEFBB6F0A06871275068|yrrT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTGTCACACTCCATA, downstream forward: _UP4_TAAAGTGAAGGGAATGTGAA
  • References

  • 17056751,16513748,12642660,16885442