SubtiBank SubtiBank
galM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

galM

aldose-1-epimerase
locus
BSU_18360
pI
5.60
mw
37.07 kDa
protein length
325 aa Sequence Blast
gene length
978 bp Sequence Blast
function
unknown
product
aldose-1-epimerase (mutarotase)
essential
no
synonyms
yoxA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.8|Utilization of galactose]
  • Gene

    Coordinates
    1,999,849 2,000,826

    The protein

    Catalyzed reaction/ biological activity

  • aldose-1-epimerase (mutarotase) [Pubmed|19758330]
  • α-D-glucose --> β-D-glucose (according to UniProt)
  • Protein family

  • aldose epimerase family (single member, according to UniProt)
  • Structure

  • [PDB|3MWX]
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|993A863ED80BA5970C9145A35D407834B322C9DC|galM]-[gene|20A3120D2A45449745C9162EDCF386ED3163851B|dacC]
    description
    [Pubmed|9733705]

    sigma factors

  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|9733705], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10482513], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE18360 ([gene|993A863ED80BA5970C9145A35D407834B322C9DC|galM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTACTCAACCTCTCC, downstream forward: _UP4_TAGCCAATGATGAAGCGCAG
  • BKK18360 ([gene|993A863ED80BA5970C9145A35D407834B322C9DC|galM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTACTCAACCTCTCC, downstream forward: _UP4_TAGCCAATGATGAAGCGCAG
  • References

  • 9733705,10482513,19758330