SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


aminotransferase involved in bacilysin synthesis
44.54 kDa
protein length
399 aa Sequence Blast
gene length
1200 bp Sequence Blast
biosynthesis of the antibiotic bacilysin
pyridoxal 5-phosphate-dependent stereospecific aminotransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    3,868,287 3,869,486

    The protein

    Catalyzed reaction/ biological activity

  • YwfG catalyzes transamination of tetrahydro-4-hydroxyphenylpyruvate (with L-Phe as amino donor), to form tetrahydrotyrosine [Pubmed|20052993]
  • Protein family

  • [SW|class-I pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|938E08D2C50649A52EC06B9A08C6A73598E68CE1|MtnE]
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|6L1L] (apo-protein) [pubmed|32134000]
  • [PDB|6L1N] (substrate-bound) [pubmed|32134000]
  • [PDB|6L1O] (product-bound) [pubmed|32134000]
  • [PDB|2O1B] (from Staphylococcus aureus, 40% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|19801406], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12372825,21709425], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|12697329,21709425], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19801406], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • regulation

  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials


  • MGNA-A514 (ywfG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE37690 ([gene|99434727013FCCD6E570AE550560A8546F7F2A41|bacF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACATCGGACGGTGTTATTT, downstream forward: _UP4_TCCCGCTAAAAAGCGGGATG
  • BKK37690 ([gene|99434727013FCCD6E570AE550560A8546F7F2A41|bacF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACATCGGACGGTGTTATTT, downstream forward: _UP4_TCCCGCTAAAAAGCGGGATG
  • References

  • 12372825,19801406,20052993,21948839,12697329,21709425,32134000