SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


glyoxal reductase, general stress protein
31.51 kDa
protein length
276 aa Sequence Blast
gene length
831 bp Sequence Blast
glyoxal reductase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    3,426,749 3,427,579

    The protein

    Catalyzed reaction/ biological activity

  • Lactaldehyde + NADP+ --> methylglyoxal + NADPH (according to UniProt)
  • Protein family

  • [SW|Aldo/keto reductase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|DE12190315DADF13DA1BA272924729BBF909B1D9|YtbE]
  • [SW|Cofactors]

  • NADP+ [pubmed|31165224]
  • Structure

  • [PDB|3B3E] [Pubmed|19585557]
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|16430695], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • view in new tab

    Biological materials


  • MGNA-B061 (yvgN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33400 ([gene|994D5A36AECC75F5D0B59F7755BC5DB935ED6CE8|yvgN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTGAACCTCCACCCTTT, downstream forward: _UP4_TAATCAAAAAACTCCCCGTT
  • BKK33400 ([gene|994D5A36AECC75F5D0B59F7755BC5DB935ED6CE8|yvgN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTGAACCTCCACCCTTT, downstream forward: _UP4_TAATCAAAAAACTCCCCGTT
  • References

  • 16232966,16430695,19585557,15805528,31165224