SubtiBank SubtiBank


glyoxal reductase, general stress protein
31.51 kDa
protein length
276 aa Sequence Blast
gene length
831 bp Sequence Blast
glyoxal reductase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    3,426,749 3,427,579

    The protein

    Catalyzed reaction/ biological activity

  • Lactaldehyde + NADP+ --> methylglyoxal + NADPH (according to UniProt)
  • Protein family

  • [SW|Aldo/keto reductase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|DE12190315DADF13DA1BA272924729BBF909B1D9|YtbE]
  • [SW|Cofactors]

  • NADP+ [pubmed|31165224]
  • Structure

  • [PDB|3B3E] [Pubmed|19585557]
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|16430695], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • view in new tab

    Biological materials


  • MGNA-B061 (yvgN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33400 ([gene|994D5A36AECC75F5D0B59F7755BC5DB935ED6CE8|yvgN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTGAACCTCCACCCTTT, downstream forward: _UP4_TAATCAAAAAACTCCCCGTT
  • BKK33400 ([gene|994D5A36AECC75F5D0B59F7755BC5DB935ED6CE8|yvgN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTGAACCTCCACCCTTT, downstream forward: _UP4_TAATCAAAAAACTCCCCGTT
  • References

  • 16232966,16430695,19585557,15805528,31165224