SubtiBank SubtiBank
nucA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

nucA

membrane-associated nuclease, catalyzes DNA cleavage during transformation
locus
BSU_03430
pI
4.68
mw
16.12 kDa
protein length
147 aa Sequence Blast
gene length
444 bp Sequence Blast
function
genetic transformation, DNA uptake
product
membrane-associated nuclease
essential
no
synonyms
comI

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    372,154 372,597

    The protein

    Structure

  • [PDB|5OMT] ([protein|search|NucB ]from B. licheniformis, 64% identity, aa 40 - 147) [pubmed|29165717]
  • [SW|Localization]

  • integral membrane protein [Pubmed|11359569]
  • Expression and Regulation

    Operons

    genes
    [gene|99581CC6AFFA2D1392748B4D9C99DEF8B7601F75|nucA]-[gene|3A54C644DD1CCA5C08CB9C5CD648D44889E68D23|nin]
    description
    [Pubmed|11359569]

    regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|7746143], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE03430 ([gene|99581CC6AFFA2D1392748B4D9C99DEF8B7601F75|nucA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATGTTCACCTCCCGCTTTT, downstream forward: _UP4_TAAACAGTACATAGAGGAGG
  • BKK03430 ([gene|99581CC6AFFA2D1392748B4D9C99DEF8B7601F75|nucA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATGTTCACCTCCCGCTTTT, downstream forward: _UP4_TAAACAGTACATAGAGGAGG
  • References

  • 11814663,11359569,7746143,29165717