SubtiBank SubtiBank
phrE
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

phrE

response regulator aspartate phosphatase (RapE) regulator, control of the phosphorelay
locus
BSU_25840
pI
8.86
mw
4.72 kDa
protein length
gene length
135 bp Sequence Blast
function
control of sporulation initiation
product
phosphatase (RapE) regulator
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.3|Control of response regulators/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW 3.4.7.6|Other protein controlling the activity of the phosphorelay]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW 4.2.2.6|Other protein controlling the activity of the phosphorelay]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • [category|SW 6|Groups of genes] → [category|SW 6.8|Short peptides]
  • Gene

    Coordinates
    2,660,330 2,660,464

    The protein

    Protein family

  • [SW|phr family] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|997434F9679B3A2F8D2453D0C3BAB24F5BB90922|phrE]
    description
    [Pubmed|11466295]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11466295], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|11466295], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • regulation

  • repressed by glucose (10-fold) ([protein|search|CcpA]) [Pubmed|12850135]
  • view in new tab

    genes
    [gene|8B8646DF7F437D8DB299A77BA937DC6FC082102F|rapE]-[gene|997434F9679B3A2F8D2453D0C3BAB24F5BB90922|phrE]
    description
    [Pubmed|11466295,10629174]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|23569278,12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • regulation

  • repressed by glucose (10-fold) ([protein|search|CcpA]) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • BKE25840 ([gene|997434F9679B3A2F8D2453D0C3BAB24F5BB90922|phrE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACGGCGGATAAACTGATAA, downstream forward: _UP4_TAATTCGATAAACAACATTA
  • BKK25840 ([gene|997434F9679B3A2F8D2453D0C3BAB24F5BB90922|phrE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACGGCGGATAAACTGATAA, downstream forward: _UP4_TAATTCGATAAACAACATTA
  • References

  • 12618455,12850135,11466295,10629174,21821766,20817675