SubtiBank SubtiBank
pelC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pelC

pectate lyase C
locus
BSU_34950
pI
9.14
mw
24.13 kDa
protein length
221 aa Sequence Blast
gene length
666 bp Sequence Blast
function
degradation of polygalacturonic acid
product
pectate lyase C
essential
no
ec
4.2.2.2
synonyms
yvpA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.27|Utilization of other polymeric carbohydrates]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    3,590,603 3,591,268

    The protein

    Catalyzed reaction/ biological activity

  • Eliminative cleavage of (1->4)-alpha-D-galacturonan to give oligosaccharides with 4-deoxy-alpha-D-galact-4-enuronosyl groups at their non-reducing ends (according to UniProt)
  • Protein family

  • polysaccharide lyase 3 family (single member, according to UniProt)
  • Structure

  • [PDB|1EE6] (from Bacillus sp., 58% identity) [pubmed|11717490]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|950D355D993DF79AD5288A00AA04A775637AC04D|yvpB]-[gene|99ECA1B305145A63BD3A72094EF24F56D875BCC1|pelC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A382 (yvpA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/382 NBRP B. subtilis, Japan]
  • BKE34950 ([gene|99ECA1B305145A63BD3A72094EF24F56D875BCC1|pelC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGATAAATCCTCCCCGG, downstream forward: _UP4_TTTTAACAAAAAAAGTCCGC
  • BKK34950 ([gene|99ECA1B305145A63BD3A72094EF24F56D875BCC1|pelC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGATAAATCCTCCCCGG, downstream forward: _UP4_TTTTAACAAAAAAAGTCCGC
  • References

  • 18957862,16514142,20525796,24236123,11717490