SubtiBank SubtiBank
yokL
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yokL

similar to spermidine/spermine N-acetyltransferase
locus
BSU_21550
pI
4.78
mw
20.71 kDa
protein length
177 aa Sequence Blast
gene length
534 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,273,989 2,274,522

    The protein

    Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 11-170) (according to UniProt)
  • Structure

  • [PDB|6DAU] (SpeG from Vibrio cholerae, 27% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|13C081250872E72C61C49D8F77AC5AF4B6D431A3|yokI]-[gene|9BC2309D7FC93CD4195849BFCF195ED3EBC3CAF1|yokJ]-[gene|8BA8DB1483190AB847F28F3E56C247FE85C3225E|yokK]-[gene|9A03964C94A9253B3D9AAA60ACA0651AED49A627|yokL]
    description
    [Pubmed|20817675]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yolA]' and '[protein|search|yokL]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • BKE21550 ([gene|9A03964C94A9253B3D9AAA60ACA0651AED49A627|yokL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTAACTTTCCCTCCAG, downstream forward: _UP4_TAATATCACTTGTGCATCGA
  • BKK21550 ([gene|9A03964C94A9253B3D9AAA60ACA0651AED49A627|yokL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTAACTTTCCCTCCAG, downstream forward: _UP4_TAATATCACTTGTGCATCGA
  • References

  • 20525796,20817675