SubtiBank SubtiBank
ldcB

ldcB

LD-carboxypeptidase, releases D-Ala from the cell wall
locus
BSU_19620
pI
5.84
mw
30.70 kDa
protein length
273 aa Sequence Blast
gene length
822 bp Sequence Blast
function
cell wall synthesis
product
LD-carboxypeptidase
essential
no
synonyms
yodJ

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.1|Biosynthesis of peptidoglycan]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.1|Biosynthesis of peptidoglycan]
  • Gene

    Coordinates
    2,134,566 2,135,387

    The protein

    Catalyzed reaction/ biological activity

  • trimming of cell wall peptides (tetrapeptides to tripeptides) wit concomitant release of D-ala [Pubmed|24909784]
  • Protein family

  • peptidase M15B family (single member, according to UniProt)
  • [SW|Cofactors]

  • Zn2+ [Pubmed|24909784]
  • Structure

  • [PDB|4OX3] [Pubmed|24909784]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|3075327DBE55C4F628171AEE248CAED5870693FA|deoD]-[gene|9A22825FD67B6A205807433D0B4908F86E5AB343|ldcB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B439 (yodJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1438 NBRP B. subtilis, Japan]
  • BKE19620 ([gene|9A22825FD67B6A205807433D0B4908F86E5AB343|ldcB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTACATTACCTTCCTT, downstream forward: _UP4_TAAAATGAAAAGCCCGCTTA
  • BKK19620 ([gene|9A22825FD67B6A205807433D0B4908F86E5AB343|ldcB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTACATTACCTTCCTT, downstream forward: _UP4_TAAAATGAAAAGCCCGCTTA
  • References

  • 18957862,24909784,22383849,21378199