SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


formyltetrahydrofolate deformylase
34.34 kDa
protein length
300 aa Sequence Blast
gene length
903 bp Sequence Blast
purine nucleotide synthesis
formyltetrahydrofolate deformylase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of purine nucleotides]
  • Gene

    1,377,243 1,378,145

    The protein

    Catalyzed reaction/ biological activity

  • (6S)-10-formyltetrahydrofolate + H2O --> (6S)-5,6,7,8-tetrahydrofolate + formate + H+ (according to UniProt)
  • Protein family

  • PurU family (single member, according to UniProt)
  • Paralogous protein(s)

  • [protein|7B30F27D6C459437967A64467E52961F4A9E0F2C|PurN]
  • [SW|Domains]

  • [SW|ACT domain] (aa 21-102) (according to UniProt)
  • Structure

  • [PDB|3W7B] (from ''Thermus thermophilus'', 58% identity) [Pubmed|24108189]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B310 (ykkE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13110 ([gene|9A399CAA672C3DF90531A7A7168916DE86EFA365|ykkE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATAATCCCTCTTATC, downstream forward: _UP4_TAGACTGCAAGAGGCCCGCG
  • BKK13110 ([gene|9A399CAA672C3DF90531A7A7168916DE86EFA365|ykkE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATAATCCCTCTTATC, downstream forward: _UP4_TAGACTGCAAGAGGCCCGCG
  • References

  • 24108189,22383849