SubtiBank SubtiBank
ymfH
The papers of the month are back! Check them out! Link here

ymfH

similar to peptidase
locus
BSU16860
pI
4.94
mw
47.04 kDa
protein length
415 aa Sequence Blast
gene length
1245 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,758,314 → 1,759,600

    Expression and Regulation

    Operons

    genes
    [gene|11997FE6BA6947E7C7E3DBE20B49C9FB758262B2|ymfD]-[gene|43BADA6A6C8248270A50EB3D81253ECE6C84F03F|ymfF]-[gene|9A5EB7CA38D948007AD788297128035AB4074490|ymfH]
    description
    [Pubmed|18502870]

    regulatory mechanism

  • [protein|A7326377132C670B60695EFE0A652B1E4F623698|Mta]: activation, [Pubmed|18502870], in [regulon|A7326377132C670B60695EFE0A652B1E4F623698|Mta regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A025 (ymfH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/25 NBRP B. subtilis, Japan]
  • BKE16860 (Δ[gene|9A5EB7CA38D948007AD788297128035AB4074490|ymfH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGTTCATATTCGATTGGTT, downstream forward: _UP4_TAAACAAAACATCCCTCCAG
  • BKK16860 (Δ[gene|9A5EB7CA38D948007AD788297128035AB4074490|ymfH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGTTCATATTCGATTGGTT, downstream forward: _UP4_TAAACAAAACATCCCTCCAG
  • References

  • 18502870