SubtiBank SubtiBank
ycsG
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ycsG

putative transporter
locus
BSU_04060
pI
10.15
mw
41.93 kDa
protein length
404 aa Sequence Blast
gene length
1215 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ycsH

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    457,811 459,025

    Phenotypes of a mutant

  • no growth with 5-oxoproline as single source of nitrogen [pubmed|28830929]
  • The protein

    Protein family

  • NRAMP family (with [protein|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|MntH], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|77F758CE9A59AC41F283CB1F5099097386133799|pxpA]-[gene|9AD419E3CB86C54A0F11E96C82E80A357C6B23D2|ycsG]-[gene|312E2A4ADFBCB9DD9AD9EEEC9FE53F3932AF5DBA|ycsI]-[gene|5A5E17D39296FECC1C03B1A7791AB1065BB4E4DF|pxpB]-[gene|3BA8F1F71B1D65EB30867ABD27867F925DAD2D7B|pxpC]-[gene|7DA9A79876C546B78B716A64706A3A3716018C2E|kipR]-[gene|05910B4500420D4DB75DAD3A7A2358C360FF2154|lipC]
    description
    [Pubmed|9334321]

    regulatory mechanism

  • [protein|7DA9A79876C546B78B716A64706A3A3716018C2E|KipR]: repression, [Pubmed|9334321], in [regulon|7DA9A79876C546B78B716A64706A3A3716018C2E|KipR regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|9334321], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • induced in the presence of 5-oxoproline [pubmed|28830929]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C022 (ycsG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2020 NBRP B. subtilis, Japan]
  • BKE04060 ([gene|9AD419E3CB86C54A0F11E96C82E80A357C6B23D2|ycsG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGCTCCATCTATTGTTCCT, downstream forward: _UP4_TGATATAAGTGGAGCAATTA
  • BKK04060 ([gene|9AD419E3CB86C54A0F11E96C82E80A357C6B23D2|ycsG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGCTCCATCTATTGTTCCT, downstream forward: _UP4_TGATATAAGTGGAGCAATTA
  • References

  • 9334321,25755103,28830929