SubtiBank SubtiBank
yaaK
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yaaK

similar to DNA-binding protein
locus
BSU_00200
pI
4.54
mw
11.64 kDa
protein length
107 aa Sequence Blast
gene length
324 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    28,529 28,852

    The protein

    Protein family

  • YbaB/EbfC family (single member, according to UniProt)
  • Structure

  • [PDB|1YBX] (from Clostridium thermocellum, 53% identity)
  • [SW|Localization]

  • nucleoid (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|73D063EDC412F7F28DA27C986ECCCD1C4A1F6618|dnaX]-[gene|9AFCEFE83560B1E2B1FFD7CFD2E4F17FAE137889|yaaK]-[gene|BEBAF1EB53EBB3E7558BB5FE73C418B50000FA29|recR]-[gene|C5127208E7562F09249112240F0BE8C582B2E5AD|yaaL]-[gene|CB5D3A2E5BEE336539BEB2D7C5D9C3A63C78FD01|bofA]
    description
    [Pubmed|22383849]
    view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials

    Mutant

  • MGNA-B892 (yaaK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1891 NBRP B. subtilis, Japan]
  • BKE00200 ([gene|9AFCEFE83560B1E2B1FFD7CFD2E4F17FAE137889|yaaK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCATTCACTCTCTTTC, downstream forward: _UP4_TTATTCTAGGGGGATAAAAG
  • BKK00200 ([gene|9AFCEFE83560B1E2B1FFD7CFD2E4F17FAE137889|yaaK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCATTCACTCTCTTTC, downstream forward: _UP4_TTATTCTAGGGGGATAAAAG
  • References

  • 12884008,19594923