SubtiBank SubtiBank
yqfQ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yqfQ

late sporulation protein
locus
BSU_25150
pI
10.52
mw
25.75 kDa
protein length
247 aa Sequence Blast
gene length
744 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,595,669 2,596,412

    The protein

    [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|9B1EA9872500280D6360EECD3D7344A1974910CA|yqfQ]-[gene|08F1D9AD2D51D8513AFFA57E8ED69DB8EF97AD88|ispH]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|9B1EA9872500280D6360EECD3D7344A1974910CA|yqfQ]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|12480901], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed late during [SW|sporulation] in the mother cell ([protein|search|SigK]) [Pubmed|12480901]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C442 (yqfQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2440 NBRP B. subtilis, Japan]
  • BKE25150 ([gene|9B1EA9872500280D6360EECD3D7344A1974910CA|yqfQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTTGTACCTCCTTTCA, downstream forward: _UP4_TAACATTCTTTGATATCTTA
  • BKK25150 ([gene|9B1EA9872500280D6360EECD3D7344A1974910CA|yqfQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTTGTACCTCCTTTCA, downstream forward: _UP4_TAACATTCTTTGATATCTTA
  • References

  • 12480901