SubtiBank SubtiBank
bmrD
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

bmrD

multidrug ABC transporter (ATP-binding protein), also involved in the signalling pathway to activate KinA at the onset of sporulation
locus
BSU09720
pI
7.08
mw
76.12 kDa
protein length
673 aa Sequence Blast
gene length
2019 bp Sequence Blast
function
multiple antibiotic resistance
product
multidrug ABC transporter (ATP-binding protein)
essential
no
synonyms
yheH

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.1|Efflux of antibiotics]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.3|Regulatory ABC transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,047,072 → 1,049,093

    The protein

    [SW|Domains]

  • has both a membrane-spanning and an ATP-binding domain [Pubmed|10092453]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|E9956A958C66C4114EB974EA6F9BF30CD951034A|bmrB]-[gene|67C0C9EA17EF953554D3D57CD0D285246F50C1AD|bmrC]-[gene|9B2766D2F8892AA17DB480216570C81C33355C3B|bmrD]
    description
    [Pubmed|25217586]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675,25217586], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|E9956A958C66C4114EB974EA6F9BF30CD951034A|BmrB]: attenuation, [Pubmed|25217586], in [regulon|E9956A958C66C4114EB974EA6F9BF30CD951034A|BmrB regulon]
  • regulation

  • ''[protein|search|bmrB]-[protein|search|bmrC]-[protein|search|bmrD]'' expression only occurs during the late-exponential and stationary growth stages ([protein|search|AbrB]) [Pubmed|25217586]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B491 (yheH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1490 NBRP B. subtilis, Japan]
  • BKE09720 (Δ[gene|9B2766D2F8892AA17DB480216570C81C33355C3B|bmrD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTCCATAACGTTTTTCCTA, downstream forward: _UP4_TAACGCTCAAAAACCCAAAA
  • BKK09720 (Δ[gene|9B2766D2F8892AA17DB480216570C81C33355C3B|bmrD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTCCATAACGTTTTTCCTA, downstream forward: _UP4_TAACGCTCAAAAACCCAAAA
  • References

  • 19167342,10092453,16487324,25217586,21602923