SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to type II NADH dehydrogenase (non proton-pumping)
44.77 kDa
protein length
406 aa Sequence Blast
gene length
1221 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    3,300,034 3,301,254

    The protein

    Protein family

  • NADH dehydrogenase family (with [protein|5044FDBEC8D81D1978DB431F9222902FCD80DD2D|YutJ] and [protein|56F407D408272F3674612C9CDFE4A922680EC694|Ndh], according to UniProt)
  • Paralogous protein(s)

  • [protein|56F407D408272F3674612C9CDFE4A922680EC694|Ndh]
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|4NWZ] (from Caldalkalibacillus thermarum, 62% identity) [pubmed|24444429]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B571 (yumB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32100 ([gene|9B3E9074975758BCB3D06820E4A35F8C2B78DCEB|yumB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACATCCACCTTCTCTT, downstream forward: _UP4_TAAAAACCCGCGGAAGCGGG
  • BKK32100 ([gene|9B3E9074975758BCB3D06820E4A35F8C2B78DCEB|yumB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACATCCACCTTCTCTT, downstream forward: _UP4_TAAAAACCCGCGGAAGCGGG
  • References

  • 17015645,19935659,24444429