SubtiBank SubtiBank
gdpP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gdpP

c-di-AMP specific phosphodiesterase
locus
BSU40510
pI
4.86
mw
74.14 kDa
protein length
659 aa Sequence Blast
gene length
1977 bp Sequence Blast
function
control of sporulation initiation, cell wall homeostasis
product
c-di-AMP phosphodiesterase
essential
no
synonyms
yybT

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    4,163,643 → 4,165,622

    Phenotypes of a mutant

  • inactivation of ''[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP]'' strongly restores beta-lactam resistance in a ''[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]'' mutant [Pubmed|22211522]
  • a ''[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP] [gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]'' double mutant acquires suppressor mutations in ''[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]'' [Pubmed|26240071]
  • a ''[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP] [gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]'' double mutant is defective in [SW|biofilm formation] [Pubmed|27252699]
  • altered morphology on MSgg medium [pubmed|29588402]
  • The protein

    Catalyzed reaction/ biological activity

  • cyclic dinucleotide phosphodiesterase, hydrolysis of cyclic di-AMP [Pubmed|19901023]
  • [SW|Domains]

  • two transmembrane domains at the N-terminus [Pubmed|19901023]
  • a domain that shares minimum sequence homology with Heme-binding [PAS domain|Per-ARNT-Sim (PAS) domains] (80 aa) [Pubmed|21257773]
  • degenerate [SW|GGDEF domain] (aa 173 - 301) [Pubmed|19901023]
  • a [SW|DHH-DHHA1 domain] [Pubmed|19901023]
  • Effectors of protein activity

  • ppGpp inhibits cyclic dinucleotide phosphodiesterase activity [Pubmed|19901023]
  • Heme binding suppresses phosphodiesterase activity [Pubmed|21257773]
  • Structure

  • [PDB|2M1C] (N-terminal PAS domain of GdpP from ''Geobacillus thermodenitrificans'') [Pubmed|23504327]
  • Expression and Regulation

    Operons

    genes
    [gene|6640C754249DD8E4E15889CC838F5D04A682BF58|yybS]-[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP]-[gene|56737276B364EC0BC7391F1BA15F225C352ED905|rplI]
    description
    [Pubmed|22383849]

    additional information

  • term-seq has identified a potential novel regulatory RNA element including an intrinsic transcription terminator upstream of ''yybS'' [Pubmed|27120414]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B834 (yybT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1833 NBRP B. subtilis, Japan]
  • GP998 (''[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP]''::''spc''), available in [SW|Jörg Stülke]'s lab [Pubmed|23192352]
  • GP2040 (''[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP]''::''spc'' ''[gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]''::''erm'' without terminator, available in [SW|Jörg Stülke]'s lab) [Pubmed|26240071]
  • BKE40510 (Δ[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTATCACTCCCCACC, downstream forward: _UP4_AGATGAAGGTTATTTTCTTA
  • BKK40510 (Δ[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTATCACTCCCCACC, downstream forward: _UP4_AGATGAAGGTTATTTTCTTA
  • References

    Reviews

  • 25869574,26773214,30224435
  • Original publications

  • 19901023,21257773,21566650,23504327,22211522,22956758,25616256,26240071,27252699,29588402
  • GdpP homologs in other organisms

  • 18502872