SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


extracellular polysaccharide synthesis, protein tyrosine kinase, phosphorylation of [protein|5D717F9F54693FD0AA8BC49E10348637858F88B9|EpsE]
24.53 kDa
protein length
227 aa Sequence Blast
gene length
684 bp Sequence Blast
biofilm formation
protein tyrosine kinase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Matrix polysaccharide synthesis]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.7|Phosphorylation on a Tyr residue]
  • Gene

    3,528,462 3,529,145

    The protein

    Catalyzed reaction/ biological activity

  • phosphorylation of [protein|5D717F9F54693FD0AA8BC49E10348637858F88B9|EpsE], to stimulate [protein|5D717F9F54693FD0AA8BC49E10348637858F88B9|EpsE] activity and biofilm formation [pubmed|25085422]
  • ATP + L-tyrosyl-[protein] --> ADP + H+ + O-phospho-L-tyrosyl-[protein] (according to UniProt)
  • Protein family

  • BY kinase, see the [ Bacterial Protein Tyrosine Kinase Database]
  • CpsD/CapB family (with [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA], according to UniProt)
  • Paralogous protein(s)

  • [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA]
  • Modification

  • autophosphorylated on Tyr-225 and Tyr-227 [Pubmed|25085422]
  • Structure

  • [PDB|2VED] (CapB, the homolog in ''Staphylococcus aureus'') [Pubmed|18547145]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15661000], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]) [Pubmed|23646920], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [regulon|EAR riboswitch|EAR riboswitch]: processive antitermination, in [regulon|EAR riboswitch|EAR riboswitch]
  • regulation

  • repressed by [protein|search|SinR] [Pubmed|15661000]
  • additional information

  • induction by sequestration of [protein|search|SinR] by [protein|search|SinI] or [protein|search|SlrA] [PubMed|15661000,19788541]
  • view in new tab

    Biological materials


  • MGNA-A072 (yveL::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1518 (aphA3) [Pubmed|24493247], available in [SW|Jörg Stülke]'s lab
  • GP1519 (''[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]-[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]'', aphA3) [Pubmed|24493247], available in [SW|Jörg Stülke]'s lab
  • BKE34360 ([gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTTTTCTAAAGATCACTC, downstream forward: _UP4_TAGTTTTTGTAAAGGTGATG
  • BKK34360 ([gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTTTTCTAAAGATCACTC, downstream forward: _UP4_TAGTTTTTGTAAAGGTGATG
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]) [Pubmed|24493247], available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1541 epsB-FLAG 3x spc (based on [SW|pGP1331]) available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [ homepage]
  • References


  • 20735481,24554699,25540643
  • Original publications

  • 15661000,16430695,18047568,18647168,18547145,20817675,21856853,21815947,23646920,24493247,24728941,25085422