SubtiBank SubtiBank
coaX
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

coaX

type III pantothenate kinase
locus
BSU_00700
pI
8.37
mw
26.07 kDa
protein length
258 aa Sequence Blast
gene length
777 bp Sequence Blast
function
biosynthesis of coenzyme A
product
pantothenate kinase
essential
no
ec
2.7.1.33
synonyms
yacB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.4|Biosynthesis of coenzyme A]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    79,092 79,868

    The protein

    Catalyzed reaction/ biological activity

  • (R)-pantothenate + ATP --> (R)-4'-phosphopantothenate + ADP + H+ (according to UniProt)
  • Protein family

  • type III pantothenate kinase family (single member, according to UniProt)
  • Structure

  • [PDB|2H3G] (from ''Bacillus anthracis str. ames'', 75% identity, 88% similarity) [Pubmed|17323930]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|9B8EAD4EDDA97526D4462F6F3205F81FECD039DE|coaX]-[gene|D579A7E4D8C3DEE4F85586C5F721CAD5FE2BCA75|yacC]-[gene|548926987569033AA0C40610B8E80FB2BB8E1E3A|yacD]-[gene|D1FC976597E5583E40A4ED7234FBCA743AB01354|cysK]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [pubmed|30480837], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • induced by heat stress ([protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]) [pubmed|30480837]
  • view in new tab

    genes
    [gene|9B8EAD4EDDA97526D4462F6F3205F81FECD039DE|coaX]-[gene|D579A7E4D8C3DEE4F85586C5F721CAD5FE2BCA75|yacC]
    description
    [Pubmed|18179421]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B923 (yacB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1922 NBRP B. subtilis, Japan]
  • BKE00700 ([gene|9B8EAD4EDDA97526D4462F6F3205F81FECD039DE|coaX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACCTCTATCACCACTTTT, downstream forward: _UP4_GGAAGTGTATAGGAGGTTTA
  • BKK00700 ([gene|9B8EAD4EDDA97526D4462F6F3205F81FECD039DE|coaX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACCTCTATCACCACTTTT, downstream forward: _UP4_GGAAGTGTATAGGAGGTTTA
  • References

  • 15795230,18179421,24784177