SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


amino acid permease
51.56 kDa
protein length
470 aa Sequence Blast
gene length
1413 bp Sequence Blast
arginine, ornithine and citrulline uptake
amino acid permease

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|APC superfamily]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of arginine]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of arginine/ ornithine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,875,780 3,877,192

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|RocE], [protein|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|YbgF], [protein|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|YdgF], [protein|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|AapA], [protein|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|GabP], [protein|219586A3F378DC38EA076FD39B99D41136BDE722|YtnA], [protein|423AEC9D260BE53AD22851D999244B89BEB3E84D|HutM], [protein|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|YvbW], [protein|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|YbxG]
  • Structure

  • [PDB|6F34] (from Geobacillus kaustophilus, 24% identity) [pubmed|29416041]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [Pubmed|8113162], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR]: activation, [Pubmed|8113162], in [regulon|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR regulon]
  • [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]: activation, [Pubmed|7565595], in [regulon|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • additional information

  • expression of the ''[protein|search|rocA]-[protein|search|rocB]-[protein|search|rocC]'' operon is increased upon depletion of ''[SW|nusA]'' (resulting from increased ''[SW|ahrC]'' expression) [ Reference]
  • view in new tab

    Biological materials


  • BKE37760 ([gene|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|rocC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCATTTTTATGATTCT, downstream forward: _UP4_TAGAAAAAGCTCTCCGGGAG
  • BKK37760 ([gene|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|rocC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCATTTTTATGATTCT, downstream forward: _UP4_TAGAAAAAGCTCTCCGGGAG
  • References

  • 12618455,8113162,7565595,29416041