SubtiBank SubtiBank
yhcJ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yhcJ

similar to [SW|ABC transporter] (binding lipoprotein)
locus
BSU_09110
pI
5.09
mw
29.04 kDa
protein length
276 aa Sequence Blast
gene length
831 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.4|Unknown ABC transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    984,901 985,731

    The protein

    Protein family

  • nlpA lipoprotein family (with [protein|0481A9C134A6EEC6F111AD0C03E2E345D6A315A0|MetQ], according to UniProt)
  • Paralogous protein(s)

  • [protein|0481A9C134A6EEC6F111AD0C03E2E345D6A315A0|MetQ]
  • Structure

  • [PDB|4QHQ] (from Burkholderia cenocepacia, 34% identity)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|9BFC99C85F7BEA5FEA6B8E82D205EED02375240E|yhcJ]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A655 (yhcJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/655 NBRP B. subtilis, Japan]
  • BKE09110 ([gene|9BFC99C85F7BEA5FEA6B8E82D205EED02375240E|yhcJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGACCATACTCCTAT, downstream forward: _UP4_AAGAATGAATTCGAACATTG
  • BKK09110 ([gene|9BFC99C85F7BEA5FEA6B8E82D205EED02375240E|yhcJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGACCATACTCCTAT, downstream forward: _UP4_AAGAATGAATTCGAACATTG