SubtiBank SubtiBank
cotC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

cotC

spore coat protein (outer)
locus
BSU_17700
pI
9.56
mw
14.64 kDa
protein length
gene length
201 bp Sequence Blast
function
resistance of the spore
product
spore coat protein (outer)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • Gene

    Coordinates
    1,904,995 1,905,195

    The protein

    Paralogous protein(s)

  • [protein|EB690FA075EAC3E298C47AED082B5FC21E8F8F46|CotU]
  • [SW|Localization]

  • outer spore coat, more abundant at the mother cell-distal pole of the forespore [Pubmed|19933362]
  • the [protein|9C59B51FC19FC83BD14272008BD441833DD1738E|CotC]-[protein|EB690FA075EAC3E298C47AED082B5FC21E8F8F46|CotU] complex assembles around the forming spore [Pubmed|18065538]
  • Expression and Regulation

    Operons

    genes
    [gene|9C59B51FC19FC83BD14272008BD441833DD1738E|cotC]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|1518043], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|1518043], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|10788508], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE], [SW|SpoIIID]) [Pubmed|1518043,10788508]
  • view in new tab

    Biological materials

    Mutant

  • 1S103 ( ''cotC''::''cat''), [Pubmed|2821284], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S103&Search=1S103 BGSC]
  • BKE17700 ([gene|9C59B51FC19FC83BD14272008BD441833DD1738E|cotC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATACTCCTCCTTTAT, downstream forward: _UP4_TAAACGCCATTAACATCTCC
  • BKK17700 ([gene|9C59B51FC19FC83BD14272008BD441833DD1738E|cotC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATACTCCTCCTTTAT, downstream forward: _UP4_TAAACGCCATTAACATCTCC
  • References

    Reviews

  • 27227299
  • Original Publications

  • 19933362,1518043,2821284,12031481,1691789,18065538,10788508,20023017,15470121,26953338