SubtiBank SubtiBank
ybdN
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ybdN

unknown
locus
BSU_02040
pI
8.80
mw
31.35 kDa
protein length
285 aa Sequence Blast
gene length
858 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    224,075 224,932

    The protein

    [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|9C9F5F02DE6E08986072307EED78A931672AC642|ybdN]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed during logarithmic growth ([protein|search|AbrB]) [Pubmed|18840696]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B959 (ybdN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1958 NBRP B. subtilis, Japan]
  • BKE02040 ([gene|9C9F5F02DE6E08986072307EED78A931672AC642|ybdN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAAACAACCTCCTTTT, downstream forward: _UP4_TAACTTATACCGAGCCGGTT
  • BKK02040 ([gene|9C9F5F02DE6E08986072307EED78A931672AC642|ybdN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAAACAACCTCCTTTT, downstream forward: _UP4_TAACTTATACCGAGCCGGTT
  • References

  • 18957862,18840696,20709850