SubtiBank SubtiBank
yurZ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yurZ

unknown
locus
BSU_32720
pI
4.63
mw
13.54 kDa
protein length
125 aa Sequence Blast
gene length
378 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    3,361,305 3,361,682

    Expression and Regulation

    Operons

    genes
    [gene|9CC242C837A8C3F4D6842DD0843C561C34574856|yurZ]-[gene|45ECDC92989453F01CD1A4D12DCFAB9807454338|yuzK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B588 (yurZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1587 NBRP B. subtilis, Japan]
  • BKE32720 ([gene|9CC242C837A8C3F4D6842DD0843C561C34574856|yurZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTTAACATTCCTTT, downstream forward: _UP4_TAAGAGAAGGAATATTCCGA
  • BKK32720 ([gene|9CC242C837A8C3F4D6842DD0843C561C34574856|yurZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTTAACATTCCTTT, downstream forward: _UP4_TAAGAGAAGGAATATTCCGA