SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


43.77 kDa
protein length
394 aa Sequence Blast
gene length
1185 bp Sequence Blast
utilization of deoxyribose

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    2,447,246 2,448,430

    The protein

    Catalyzed reaction/ biological activity

  • α-D-ribose 1-phosphate --> D-ribose 5-phosphate (according to UniProt)
  • 2-deoxy-α-D-ribose 1-phosphate --> 2-deoxy-D-ribose 5-phosphate (according to UniProt)
  • Protein family

  • phosphopentomutase family (single member, according to UniProt)
  • Modification

  • phosphorylation on (Thr-87 OR Thr-89) [Pubmed|17218307,17726680]
  • Structure

  • [PDB|3M8W] (from ''B. cereus'', 77% identity, 86% similarity) [Pubmed|21193409]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10537218], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced in the presence of nucleosides (deoxyribose 5-phosphate and ribose 5-phosphate act as molecular inducers) [Pubmed|10537218]
  • view in new tab

    Biological materials


  • BKE23500 ([gene|9D07E43BF1FFB13CCEAC2B7AAA4EBDFB1079DD74|drm]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTGAAAGCCTCCTTTT, downstream forward: _UP4_TAGGGGGACTGTTTCTTGAA
  • BKK23500 ([gene|9D07E43BF1FFB13CCEAC2B7AAA4EBDFB1079DD74|drm]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTGAAAGCCTCCTTTT, downstream forward: _UP4_TAGGGGGACTGTTTCTTGAA
  • References

  • 10537218,17218307,17726680,22900538