SubtiBank SubtiBank
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website


surfactin synthetase / competence
27.47 kDa
protein length
242 aa Sequence Blast
gene length
729 bp Sequence Blast
antibiotic synthesis
surfactin synthetase / competence

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.4|Swarming]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    402,388 403,116

    The protein

    Protein family

  • thioesterase family (with [protein|27C362A132DDFF09E27FC919D0204D4C9E016803|YneP], according to UniProt)
  • Structure

  • [PDB|2RON] [pubmed|18704089]
  • [PDB|2K2Q]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1715856], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|25666134], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|8830686], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, [Pubmed|1715856,16091051], in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: activation, [Pubmed|16166527], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: repression, [Pubmed|12642660], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]: repression, [Pubmed|20817675], in [regulon|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh regulon]
  • regulation

  • expressed at high cell density ([protein|search|ComA]) [Pubmed|16091051]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|hxlR]' and '[protein|search|srfAA]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • BKE03520 ([gene|9D0914FC38FFF4028C2BA5970DC87B3A1027E253|srfAD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGGCTGTCTCCTCCTTT, downstream forward: _UP4_TGATCAAAAGCGGACAGCTT
  • BKK03520 ([gene|9D0914FC38FFF4028C2BA5970DC87B3A1027E253|srfAD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGGCTGTCTCCTCCTTT, downstream forward: _UP4_TGATCAAAAGCGGACAGCTT
  • References


  • 20735481
  • Original publications

  • 18704089,16166527,17227471,17190806,8830686,1715856,12642660,16091051,22511326,20817675,15378759