SubtiBank SubtiBank
ypkP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypkP

unknown
locus
BSU_21800
pI
8.07
mw
23.12 kDa
protein length
206 aa Sequence Blast
gene length
621 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,295,982 2,296,602

    Expression and Regulation

    Operons

    genes
    [gene|9D1DAA5E69DD12FDE0FB33EA0863E0CB214120EC|ypkP]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/ypkP.html DBTBS]) null
    view in new tab

    genes
    [gene|8B515C789439354F870023E69077D2C1D709E046|ypjP]-[gene|2CB3BAF17F59A858D249619A436EF660CAA58DD5|ypjQ]-[gene|9F9643D51E9ABA537892B19312491697CECDDCCF|thyB]-[gene|B740E971204AC14BA456B8C93A86D4BDC29524FF|dfrA]-[gene|9D1DAA5E69DD12FDE0FB33EA0863E0CB214120EC|ypkP]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A895 (ypkP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/895 NBRP B. subtilis, Japan]
  • BKE21800 ([gene|9D1DAA5E69DD12FDE0FB33EA0863E0CB214120EC|ypkP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTAGAAGGCTGTAGCGAA, downstream forward: _UP4_TAAAAAAGCGCAGTCGTGAA
  • BKK21800 ([gene|9D1DAA5E69DD12FDE0FB33EA0863E0CB214120EC|ypkP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTAGAAGGCTGTAGCGAA, downstream forward: _UP4_TAAAAAAGCGCAGTCGTGAA